Search for miRNA Isoform

 

Species
 

miRNA ID: 

Sequence: 

 

Mature miR ID Search:
To find miRNA isoforms and related information in the YM500V2 database, users can search a mature miRNA.

Direction:
Please fill in the blank of the miRNA ID. Alternately, you can press the  button to fill in the blank automatically. Then, press the  button to select a pre-miRNA and set the isomiR-related options in the next page after the blank of the miRNA ID is already filled in.

Sequence Search:
To find isomiR-related information of the miRNA isoform in the YM500V2 database, users can search a sequence of a miRNA isoform.

Direction:
Please fill in the blank of the Sequence. For example, Sequence: GTTTGAGGTAGTAGATTGTATA for Homo sapiens, or TGAGGTAGTAGATTGTATATTT for Mus musculus. Alternately, you can press the  button to fill in the blank automatically. Then, press the  button to show isomiR-related information found in the YM500V2 database in the next page after the blank of the Sequence is already filled in.