Search for Novel miRNA
Sequence Search:
To find a novel mature miRNA and related information in the YM500V2 database, users can search a sequence of a novel mature miRNA in user's favor.
Direction:
Please fill in the blank of the Novel mature sequence. For example, Novel mature sequence: AACACCTCAGAAAAGGGACAGA for Homo sapiens, or TGCATACATCACCTTGTCCTGC for Mus musculus. Alternately, you can press the button to fill in the blank automatically. Then, press the button to show novel miR-related information found in the YM500V2 database in the next page after the blank of the Novel mature sequence is already filled in.
Sequence Search:
To find a novel mature miRNA and related information in the YM500V2 database, users can search the specific genomic position.
Direction:
Please fill in the blank of the Chromosome and Location (start site). For example, Chromosome: 10 and Location: 114468900. Then, press the button to show novel miR-related information found in the YM500 database in the next page after the blanks of Chromosome and Location are already filled in.