Selected novel miR
Novel Mature miRNA Information
Expression profiles
ID: NM_hsa_1731

Sequence: AACACCTCAGAAAAGGGACAGA

Species: 

Predicted by miRDeep2: Yes

Predicted by Mireap: Yes

Predicted by miRanalyzer: Yes

Target predicted by: miRandaTargetScan





Novel Precursor miRNA(s) Information

IDChrStartEndStrandmiRDeep2MireapmiRanalyzerRegionmature miR
at 5' end
mature miR
at 3' end
Genome region
overview
EnsemblUCSCNCBI
EnsemblUCSCNCBI
EnsemblUCSCNCBI



Mature miRNA Information:
The novel miRNA user provided is found in the YM500v2 database. The expression profile in tissues and the distribution of sample counts on expression (RPM) are shown in two figures. We applied three algorithms for predicting novel miRNAs: miRanalyzer, miRDeep2 and Mireap. The target prediction results are produced from two computational approaches: miRanda and TargetScan.

Precursor miRNA(s) Information:
The mature miRNA shown above most likely belongs to the pre-miRNA(s). The structures of the pre-miRNAs (stem-loop sequence) are plotted by RNAfold. The genomic regions of the pre-miRNAs are represented by three main customized genome browsers such as Ensembl, UCSC and NCBI.

Direction:
Please select a pre-miRNA and press the  button to represent the miRNA isoforms.

References:

  1. miRDeep2: Friedländer MR, Mackowiak SD, Li N, Chen W, Rajewsky N, (2012) miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res 40(1):37-52.
  2. Mireap: Chen X et al., (2009) Identification and characterization of novel amphioxus microRNAs by Solexa sequencing. Genome Biol. 10(7):R78.
  3. miRanda: http://www.microrna.org/microrna/home.do
  4. TargetScan: http://www.targetscan.org/vert_50/seedmatch.html
  5. RNAfold: Hofacker IL, Fontana W, Stadler PF, Bonhoeffer S, Tacker M, Schuster P, (1994) Fast Folding and Comparison of RNA Secondary Structures. Monatshefte f. Chemie 125: 167-188.
  6. Ensembl: Flicek P et al., (2012) Ensembl 2012. Nucleic Acids Res. 40(Database issue):D84-90.
  7. UCSC: Kent WJ et al., (2002) The Human Genome Browser at UCSC. Genome Res. 12(6):996-1006.
  8. NCBI: Wheeler et al., (2003) NCBI Map Viewer (http://www.ncbi.nlm.nih.gov/mapview).